adalia

What is respiratory volume

& pulmonary capacity?

and help / sources you could mention would help

So we have eggies. YAYY!!

but we have a dilemma toooo

we have noothing to feed them once they hatch :( ive read where they want live food.

we cant find a pet store that carries anything like that not BBS/worms/larvae...any suggestions?

Offspring of a random sample of roan shorthorn cattle were classified according to coat color :82 red 209 roan and 89 white.

Is this distribution inconsistent with the hypothesis that coat color is determined by a single pair of alleles with co-dominance?

How do i do this.....pls help ...i have an exam

Is there a link between gender and age of onset?

I know it happens in boys ages 2-6

but is there some link between the two as to why?

Im trying to research it, but...i'm not getting anything.

1)To recognize and bind chemical messages

2)To prohibit passage of ionized substances

3)To carry large molecules across the membrane

4)To serve as cell adhesion molecules

ʃ 5x / sqrt 1-x^2

-I know 1/sqrt 1-x^2 ....is arcsin x

But i'm lost from there

Can a sequence be bounded above but not bounded below?

Pleaseeee explain using examples

Suggest an alternative method of preparing fluorine gas.

I'm confused i thought that was the only way to prepare it from the electrolysis of a mixture of HF/KF

If the pka for ch3cooh is 4.74. a)Calculate the concentration of all species present ( ch3cooh,ch3coo, and h3o) in a 0.102 M aqueous solution of acetic acid. b)What is the pH of this solution?

Why do the elements of these groups occur as salts in nature, but they aren't found in their elemental state?

Also, why do their oxidation states never exceed +1 & +2 respectively

Orders of Reaction (half life)Help pleaseeee?

Find the half life of the following reaction, given the data below

Initial [X]/mol/dm3...... Initial Rate/mol/dm3/s

0.02.............1.6X10^-3

0.04...............3.2X10^-3

0.06...............4.8X10^-3

I don't know to do it when k isn't given :(

If i want to evaluate

e^4.25

how do i do that on the calculator on the comp?

The domain of the function given below is the set of all real numbers greater than 1/2 .

f(x)= (1/2) ^x

The range of the function given below is the set of all positive real numbers less than 4.

F(x) = 4 - 4x

f(x)= (2/5) ^ x

E. The domain of F(x) is x > 0.

F. The range of F(x) is y > 0.

Below are the recognition sites of two of these enzymes, BamHI and BclI.

BamHI, cleaves after the first G:

5’ G*GATC C 3’

3’ C CTAG*G 5’

BclI cleaves after the first T:

5’ T*GATC A 3’

3’ A CTAG*T 5’

Given the DNA shown below:

5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’

3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’

(i) If this DNA was cut with BamHI, how many DNA fragments would you expect? Write out the sequence of these double-stranded DNA fragments.

(ii) If the DNA was cut with BclI, how many DNA fragments would you expect? Write out the sequence of these double-stranded DNA fragments.

Im lost :[

A student examines a fresh preparation of cells from the leaf of Elodea at

high power. He notices that the chloroplasts are slowly moving around the periphery of the cell. What is the best explanation for this phenomenon?

I. They are compensating for a lack of mitochondria in the cells.

II. They are engaged in Brownian motion.

III. They are being moved by the cytoskeleton of the cells.

IV. They are provided with energy from the mitochondria of the cells.

Let F(x)= x^3-4x^2+24

Find: the real factors of F

Ive been working it...but its taking forever ...so far i've gotten that x+2 is a factor...