Yahoo Answers is shutting down on May 4th, 2021 (Eastern Time) and beginning April 20th, 2021 (Eastern Time) the Yahoo Answers website will be in read-only mode. There will be no changes to other Yahoo properties or services, or your Yahoo account. You can find more information about the Yahoo Answers shutdown and how to download your data on this help page.

adalia
Lalala.....
Respiration help? (PLEASEE)?
What is respiratory volume
& pulmonary capacity?
and help / sources you could mention would help
1 AnswerMedicine1 decade agoWhat to feed betta fry!! HELP?
So we have eggies. YAYY!!
but we have a dilemma toooo
we have noothing to feed them once they hatch :( ive read where they want live food.
we cant find a pet store that carries anything like that not BBS/worms/larvae...any suggestions?
5 AnswersFish1 decade agoWhat kind if statistical test is this?
Offspring of a random sample of roan shorthorn cattle were classified according to coat color :82 red 209 roan and 89 white.
Is this distribution inconsistent with the hypothesis that coat color is determined by a single pair of alleles with co-dominance?
How do i do this.....pls help ...i have an exam
1 AnswerBiology1 decade agoI need someone to help me out with Duschenne Muscular Dystrophy DMD?
Is there a link between gender and age of onset?
I know it happens in boys ages 2-6
but is there some link between the two as to why?
Im trying to research it, but...i'm not getting anything.
1 AnswerOther - Diseases1 decade agoWhich of the following is a function of membrane lipids?
1)To recognize and bind chemical messages
2)To prohibit passage of ionized substances
3)To carry large molecules across the membrane
4)To serve as cell adhesion molecules
1 AnswerBiology1 decade agoIntegration help please?
ʃ 5x / sqrt 1-x^2
-I know 1/sqrt 1-x^2 ....is arcsin x
But i'm lost from there
4 AnswersMathematics1 decade agoSequences and bounding?
Can a sequence be bounded above but not bounded below?
Pleaseeee explain using examples
2 AnswersMathematics1 decade agoWhy is the production of F2 via electrolysis of a molten fluoride salt not a feasible reaction?
Suggest an alternative method of preparing fluorine gas.
I'm confused i thought that was the only way to prepare it from the electrolysis of a mixture of HF/KF
1 AnswerChemistry1 decade agoWhats the molecular geometry of HIO4?
2 AnswersChemistry1 decade agoAcid Base Equilibria Help Pleaseee?
If the pka for ch3cooh is 4.74. a)Calculate the concentration of all species present ( ch3cooh,ch3coo, and h3o) in a 0.102 M aqueous solution of acetic acid. b)What is the pH of this solution?
1 AnswerChemistry1 decade agoGroups 1a and 2a help pleaseeee?
Why do the elements of these groups occur as salts in nature, but they aren't found in their elemental state?
Also, why do their oxidation states never exceed +1 & +2 respectively
2 AnswersChemistry1 decade agoOrders of Reaction (half life)Help pleaseeee?
Orders of Reaction (half life)Help pleaseeee?
Find the half life of the following reaction, given the data below
Initial [X]/mol/dm3...... Initial Rate/mol/dm3/s
0.02.............1.6X10^-3
0.04...............3.2X10^-3
0.06...............4.8X10^-3
I don't know to do it when k isn't given :(
2 AnswersChemistry1 decade agoLogarithm help please?
If i want to evaluate
e^4.25
how do i do that on the calculator on the comp?
4 AnswersMathematics1 decade agois this true? functions help?
The domain of the function given below is the set of all real numbers greater than 1/2 .
f(x)= (1/2) ^x
7 AnswersMathematics1 decade agotrue or false? functions help?
The range of the function given below is the set of all positive real numbers less than 4.
F(x) = 4 - 4x
9 AnswersMathematics1 decade agoAre any of these statements correct? Functions help!?
f(x)= (2/5) ^ x
E. The domain of F(x) is x > 0.
F. The range of F(x) is y > 0.
5 AnswersMathematics1 decade agoBio help pleaseee .. its on DNA?
Below are the recognition sites of two of these enzymes, BamHI and BclI.
BamHI, cleaves after the first G:
5’ G*GATC C 3’
3’ C CTAG*G 5’
BclI cleaves after the first T:
5’ T*GATC A 3’
3’ A CTAG*T 5’
Given the DNA shown below:
5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’
3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’
(i) If this DNA was cut with BamHI, how many DNA fragments would you expect? Write out the sequence of these double-stranded DNA fragments.
(ii) If the DNA was cut with BclI, how many DNA fragments would you expect? Write out the sequence of these double-stranded DNA fragments.
Im lost :[
1 AnswerBiology1 decade agoChloroplasts in elodea leaf? ?
A student examines a fresh preparation of cells from the leaf of Elodea at
high power. He notices that the chloroplasts are slowly moving around the periphery of the cell. What is the best explanation for this phenomenon?
I. They are compensating for a lack of mitochondria in the cells.
II. They are engaged in Brownian motion.
III. They are being moved by the cytoskeleton of the cells.
IV. They are provided with energy from the mitochondria of the cells.
2 AnswersBiology1 decade agoHelp with math please! polynomials..?
Let F(x)= x^3-4x^2+24
Find: the real factors of F
Ive been working it...but its taking forever ...so far i've gotten that x+2 is a factor...
4 AnswersMathematics1 decade agoHow is plantae distinguished from other eukaryotic kingdoms?
6 AnswersBiology1 decade ago
