Madhvi

HEXA: Variants cause the disease Tay-Sachs; “Tay-Sachs” allele is recessive, “normal” is dominant

SACS: Variants cause the disease autosomal recessive spastic ataxia of Charlevoix-Saguenay (ARSACS); “ARSACS” allele is recessive, “normal” is dominant

FAH: Variants cause the disease tyrosinemia (type I); “tyrosinemia” allele is recessive, “normal” is dominant

If Jethro and Francine -- who are both heterozygous at both the HEXA and SACS loci --were to have children, what is the probability of them producing a child

1. with both Tay-Sachs and ARSACS?

2. with neither Tay-Sachs nor ARSACS?

3. with at least one of the diseases?

4. with Tay-Sachs but not ARSACS?

5. that is a carrier for both diseases?

Compare the predicted polypeptides coded. With only the information thus far provided, discuss how Allele01 and Allele02 might be expected to differ in terms of relative fitness (i.e., how might selection be acting on these alleles and why?).

5'3' Frame 1 for Allele01

Met D Y Q V S S P I Y D I N Y Y T S E P C Q K I N V K Q I A A R L L P P L Y S L V F I F G F V G N Met L V I L I L I N C K R L K S Met T D I Y L L N L A I S D L F F L L T V P F W A H Y A A A Q W D F G N T Met C Q L L T G L Y F I G F F S G I F F I I L L T I D R Y L A V V H A V F A L K A R T V T F G V V T S V I T W V V A V F A S L P G I I F T R S Q K E G L H Y T C S S H F P Y S Q Y Q F W K N F Q T L K I V I L G L V L P L L V Met V I C Y S G I L K T L L R C R N E K K R H R A V R L I F T I Met I V Y F L F W A P Y N I V L L L N T F Q E F F G L N N C S S S N R L D Q A Met Q V T E T L G Met T H C C I N P I I Y A F V G E K F R N Y L L V F F Q K H I A K R F C K C C S I F Q Q E A P E R A S S V Y T R S T G E Q E I S V G L Stop

5'3' Frame 1 for Allele02

Met D Y Q V S S P I Y D I N Y Y T S E P C Q K I N V K Q I A A R L L P P L Y S L V F I F G F V G N Met L V I L I L I N C K R L K S Met T D I Y L L N L A I S D L F F L L T V P F W A H Y A A A Q W D F G N T Met C Q L L T G L Y F I G F F S G I F F I I L L T I D R Y L A V V H A V F A L K A R T V T F G V V T S V I T W V V A V F A S L P G I I F T R S Q K E G L H Y T C S S H F P Y I K D S H L G A G P A A A C H G H L L L G N P K N S A S V S K Stop E E E A Q G C E A Y L H H H D C L F S L L G S L Q H C P S P E H L P G I L W P E Stop L Q Stop L Stop Q V G P S Y A G D R D S W D D A L L H Q P H H L C L C R G E V Q K L P L S L L P K A H C Q T L L Q Met L F Y F P A R G S R A S K L S L H P I H W G A G N I C G L V

The sequences are provided as non-template (“coding”) DNA (i.e., the strands complementary to the provided sequences would be used as a template during transcription). The DNA strands run in the 5’ (left side of page) to 3’ (right side of page) direction.

>Allele01

ATGGATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACATCGGAGCCCTGCCAAAAAATCAATGTGAAGCAAATCGCAGCCCGCCTCCTGCCTCCGCTCTACTCACTGGTGTTCATCTTTGGTTTTGTGGGCAACATGCTGGTCATCCTCATCCTGATAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTCAACCTGGCCATCTCTGACCTGTTTTTCCTTCTTACTGTCCCCTTCTGGGCTCACTATGCTGCCGCCCAGTGGGACTTTGGAAATACAATGTGTCAACTCTTGACAGGGCTCTATTTTATAGGCTTCTTCTCTGGAATCTTCTTCATCATCCTCCTGACAATCGATAGGTACCTGGCTGTCGTCCATGCTGTGTTTGCTTTAAAAGCCAGGACGGTCACCTTTGGGGTGGTGACAAGTGTGATCACTTGGGTGGTGGCTGTGTTTGCGTCTCTCCCAGGAATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTCTCATTTTCCATACAGTCAGTATCAATTCTGGAAGAATTTCCAGACATTAAAGATAGTCATCTTGGGGCTGGTCCTGCCGCTGCTTGTCATGGTCATCTGCTACTCGGGAATCCTAAAAACTCTGCTTCGGTGTCGAAATGAGAAGAAGAGGCACAGGGCTGTGAGGCTTATCTTCACCATCATGATTGTTTATTTTCTCTTCTGGGCTCCCTACAACATTGTCCTTCTCCTGAACACCTTCCAGGAATTCTTTGGCCTGAATAATTGCAGTAGCTCTAACAGGTTGGACCAAGCTATGCAGGTGACAGAGACTCTTGGGATGACGCACTGCTGCATCAACCCCATCATCTATGCCTTTGTCGGGGAGAAGTTCAGAAACTACCTCTTAGTCTTCTTCCAAAAGCACATTGCCAAACGCTTCTGCAAATGCTGTTCTATTTTCCAGCAAGAGGCTCCCGAGCGAGCAAGCTCAGTTTACACCCGATCCACTGGGGAGCAGGAAATATCTGTGGGCTTGTGA

>Allele02

ATGGATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACATCGGAGCCCTGCCAAAAAATCAATGTGAAGCAAATCGCAGCCCGCCTCCTGCCTCCGCTCTACTCACTGGTGTTCATCTTTGGTTTTGTGGGCAACATGCTGGTCATCCTCATCCTGATAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTCAACCTGGCCATCTCTGACCTGTTTTTCCTTCTTACTGTCCCCTTCTGGGCTCACTATGCTGCCGCCCAGTGGGACTTTGGAAATACAATGTGTCAACTCTTGACAGGGCTCTATTTTATAGGCTTCTTCTCTGGAATCTTCTTCATCATCCTCCTGACAATCGATAGGTACCTGGCTGTCGTCCATGCTGTGTTTGCTTTAAAAGCCAGGACGGTCACCTTTGGGGTGGTGACAAGTGTGATCACTTGGGTGGTGGCTGTGTTTGCGTCTCTCCCAGGAATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTCTCATTTTCCATACATTAAAGATAGTCATCTTGGGGCTGGTCCTGCCGCTGCTTGTCATGGTCATCTGCTACTCGGGAATCCTAAAAACTCTGCTTCGGTGTCGAAATGAGAAGAAGAGGCACAGGGCTGTGAGGCTTATCTTCACCATCATGATTGTTTATTTTCTCTTCTGGGCTCCCTACAACATTGTCCTTCTCCTGAACACCTTCCAGGAATTCTTTGGCCTGAATAATTGCAGTAGCTCTAACAGGTTGGACCAAGCTATGCAGGTGACAGAGACTCTTGGGATGACGCACTGCTGCATCAACCCCATCATCTATGCCTTTGTCGGGGAGAAGTTCAGAAACTACCTCTTAGTCTTCTTCCAAAAGCACATTGCCAAACGCTTCTGCAAATGCTGTTCTATTTTCCAGCAAGAGGCTCCCGAGCGAGCAAGCTCAGTTTACACCCGATCCACTGGGGAGCAGGAAATATCTGTGGGCTTGTGA

1. Examine the two DNA sequences and determine whether mRNA from each is likely to be translated into a polypeptide, assuming transcription followed by appropriate post-transcriptional processing occurred. Explain your answer.

Explain why effective team work is essential for success in science, medicine, business, parenting, etc.

Explain why effective team work is essential for success in science, medicine, business, parenting, etc.

Why is it difficult to produce scientifically valid answers to complex problems, such as mental health or global warming? (In your answer, include an explanation of the nature of science. Relate that explanation to your answer.)

Explain, in evolutionary terms, why animals (including humans) dont have the ability to synthesize all the amino acids necessary for protein synthesis.

Identify the two DIFFERENT carbonyl groups, and explain why they the stretches are different

Here is the structure of the PET polymer:

http://upload.wikimedia.org/wikipedia/commons/arch...

And here is the IR spectrum: (it's the first one A. Polyethylene terephthalate (PETE, recycling #1) ..thanks

http://images.google.com/imgres?imgurl=http://www....

If we were forming 1,2,3,4 tetraphenylnaphthalene by Diels-Alder reaction, and using tetraphenylcyclopentadienone as diene and benzyne as dienophile...we would make benzyne from anthranilic acid and isoamyl nitrite...

My question is what could go wrong if too much anthranilic acid was added?

Refer to this experiement:

http://www.cerlabs.com/experiments/10534977766.pdf

THANKS A LOT...I appreicate your time and effort.

How do you remove the "R" group that could be added by Friedel Crafts?

What kind of technology or machinery is used in the dental office for basic procedures (such as fillings,cleaning, extractions, crowns, bridgework, dentures, etc..)

If you're familiar with any of them, please let me knowww....

Will give you a Best Answer ...thanks

Draw a mechanism of phenylmagnesium bromide reacting with product. The product is benzene.

Just explain me in words since you can't really draw...how the mechanism works

Thanks

Technology has important influences on the working lives of many people. What are the most important ethical issues raised by the ways technologies affect work?

Please give three examples.

2.

An electrochemical cell is constructed. For the two standard reduction half-reactions and potentials given below, determine the balanced spontaneous REDOX reaction and expected cell potential, Eocell, for this cell.

Au3+ + 3e- ===> Au, 1.50 V

Ag+ + e- ===> Ag, 0.80 V

In the three boxes below, write the numerical value for Eocell (to the nearest 0.01 V, omitting the "V") in box 1, the number of electrons tranferred in the balanced cell reaction as an integer in box 2, and the chemical symbol for the element that forms at the cathode in box 3.

1.

2.

3.

1.

Standard Reduction Potentials at 25°C for some Half-Reactions in Aqueous Solution

Half-Reaction Eored(V)

Au3+(aq) + 3e- ====> Au(s) 1.50

Ag+(aq) + e- ====> Ag(s) 0.80

Cu2+(aq) + 2e- ====> Cu(s) 0.34

2H+(aq) + 2e- ====> H2(g) 0.00

Pb2+(aq) + 2e- ====> Pb(s) -0.13

Cd2+(aq) + 2e- ====> Cd(s) -0.40

Zn2+(aq) + 2e- ====> Zn(s) -0.76

Al3+(aq) + 3e- ====> Al(s) -1.66

Of the following two species, which is the strongest reducing agent under aqueous conditions at standard conditions (All concentrations are 1 M at 1 atm)? Use the table of standard reduction potentials above.

1. Au(s)

2. Al(s)

What is the purpose of the salt bridge in an electrochemical cell?

1. The salt bridge is a metallic stand that supports the cell.

2. The salt bridge is another name for the standard hydrogen electrode, thus it permits the other half-reaction potential to be measured.

3. The salt bridge contains a salt (positive and negative ions) which can migrate into the cell compartments to preserve electrical neutrality in each half-reaction compartment as the cell runs spontaneously.

4. The salt bridge contains the positive and negative cell electrodes, thus permitting the Ecell to be measured.

5. The salt bridge is a wire that permits electrons to flow between the cell compartments.

Explain the answer too..thanks

The following electrochemical (galvanic) cell is constructed as given by the line notation:

Zn(s) | Zn2+(aq),1M || Cu2+(aq),1M | Cu(s)

(If you do not know what the line notation means, read about in the lab manual and/or text)

The Ecell measured for this cell is 1.10 V. Note that the concentrations of Zn2+(aq) and Cu2+(aq) are both 1M (standard conditions). Will the value of Ecell increase, decrease, or remain the same if the amount of Zn(s) metal in the anode is increased?

1. Increase

2. Decrease

3. Remain the same

1. Also, explain why?.....

Standard Reduction Potentials at 25°C for some Half-Reactions in Aqueous Solution

Half-Reaction Eored(V)

Au3+(aq) + 3e- ====> Au(s) 1.50

Ag+(aq) + e- ====> Ag(s) 0.80

Cu2+(aq) + 2e- ====> Cu(s) 0.34

2H+(aq) + 2e- ====> H2(g) 0.00

Pb2+(aq) + 2e- ====> Pb(s) -0.13

Cd2+(aq) + 2e- ====> Cd(s) -0.40

Zn2+(aq) + 2e- ====> Zn(s) -0.76

Al3+(aq) + 3e- ====> Al(s) -1.66

Of the following two species, which is the strongest oxidizing agent under aqueous conditions at standard conditions (All concentrations are 1 M at 1 atm)? Use the table of standard reduction potentials above.

1. H+(aq)

2. Zn2+(aq)

Question Details:

Can someone tell me the following things for Aluminum:

Chemical Formula/ Structure & Properties

Complete description of the structure & properties of the chemical. Include relevant reaction

Does science give guidance for ethics?? What do you think?

Give specific examples for evolutionary history if you know any