Yahoo Answers is shutting down on May 4th, 2021 (Eastern Time) and beginning April 20th, 2021 (Eastern Time) the Yahoo Answers website will be in read-only mode. There will be no changes to other Yahoo properties or services, or your Yahoo account. You can find more information about the Yahoo Answers shutdown and how to download your data on this help page.

Lv 2772 points

Madhvi

Favorite Answers11%
Answers163
  • Genetics Problems..Please help.,will give you best answer?

    HEXA: Variants cause the disease Tay-Sachs; “Tay-Sachs” allele is recessive, “normal” is dominant

    SACS: Variants cause the disease autosomal recessive spastic ataxia of Charlevoix-Saguenay (ARSACS); “ARSACS” allele is recessive, “normal” is dominant

    FAH: Variants cause the disease tyrosinemia (type I); “tyrosinemia” allele is recessive, “normal” is dominant

    If Jethro and Francine -- who are both heterozygous at both the HEXA and SACS loci --were to have children, what is the probability of them producing a child

    1. with both Tay-Sachs and ARSACS?

    2. with neither Tay-Sachs nor ARSACS?

    3. with at least one of the diseases?

    4. with Tay-Sachs but not ARSACS?

    5. that is a carrier for both diseases?

    2 AnswersBiology1 decade ago
  • Compare polypeptide codes..PLEASE HELP..will give you BEST ANSWER!!?

    Compare the predicted polypeptides coded. With only the information thus far provided, discuss how Allele01 and Allele02 might be expected to differ in terms of relative fitness (i.e., how might selection be acting on these alleles and why?).

    5'3' Frame 1 for Allele01

    Met D Y Q V S S P I Y D I N Y Y T S E P C Q K I N V K Q I A A R L L P P L Y S L V F I F G F V G N Met L V I L I L I N C K R L K S Met T D I Y L L N L A I S D L F F L L T V P F W A H Y A A A Q W D F G N T Met C Q L L T G L Y F I G F F S G I F F I I L L T I D R Y L A V V H A V F A L K A R T V T F G V V T S V I T W V V A V F A S L P G I I F T R S Q K E G L H Y T C S S H F P Y S Q Y Q F W K N F Q T L K I V I L G L V L P L L V Met V I C Y S G I L K T L L R C R N E K K R H R A V R L I F T I Met I V Y F L F W A P Y N I V L L L N T F Q E F F G L N N C S S S N R L D Q A Met Q V T E T L G Met T H C C I N P I I Y A F V G E K F R N Y L L V F F Q K H I A K R F C K C C S I F Q Q E A P E R A S S V Y T R S T G E Q E I S V G L Stop

    5'3' Frame 1 for Allele02

    Met D Y Q V S S P I Y D I N Y Y T S E P C Q K I N V K Q I A A R L L P P L Y S L V F I F G F V G N Met L V I L I L I N C K R L K S Met T D I Y L L N L A I S D L F F L L T V P F W A H Y A A A Q W D F G N T Met C Q L L T G L Y F I G F F S G I F F I I L L T I D R Y L A V V H A V F A L K A R T V T F G V V T S V I T W V V A V F A S L P G I I F T R S Q K E G L H Y T C S S H F P Y I K D S H L G A G P A A A C H G H L L L G N P K N S A S V S K Stop E E E A Q G C E A Y L H H H D C L F S L L G S L Q H C P S P E H L P G I L W P E Stop L Q Stop L Stop Q V G P S Y A G D R D S W D D A L L H Q P H H L C L C R G E V Q K L P L S L L P K A H C Q T L L Q Met L F Y F P A R G S R A S K L S L H P I H W G A G N I C G L V

    3 AnswersBiology1 decade ago
  • Translation of protein..PLEASE HELP..WILL GIVE YOU A BEST ANSWER!!!!?

    The sequences are provided as non-template (“coding”) DNA (i.e., the strands complementary to the provided sequences would be used as a template during transcription). The DNA strands run in the 5’ (left side of page) to 3’ (right side of page) direction.

    >Allele01

    ATGGATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACATCGGAGCCCTGCCAAAAAATCAATGTGAAGCAAATCGCAGCCCGCCTCCTGCCTCCGCTCTACTCACTGGTGTTCATCTTTGGTTTTGTGGGCAACATGCTGGTCATCCTCATCCTGATAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTCAACCTGGCCATCTCTGACCTGTTTTTCCTTCTTACTGTCCCCTTCTGGGCTCACTATGCTGCCGCCCAGTGGGACTTTGGAAATACAATGTGTCAACTCTTGACAGGGCTCTATTTTATAGGCTTCTTCTCTGGAATCTTCTTCATCATCCTCCTGACAATCGATAGGTACCTGGCTGTCGTCCATGCTGTGTTTGCTTTAAAAGCCAGGACGGTCACCTTTGGGGTGGTGACAAGTGTGATCACTTGGGTGGTGGCTGTGTTTGCGTCTCTCCCAGGAATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTCTCATTTTCCATACAGTCAGTATCAATTCTGGAAGAATTTCCAGACATTAAAGATAGTCATCTTGGGGCTGGTCCTGCCGCTGCTTGTCATGGTCATCTGCTACTCGGGAATCCTAAAAACTCTGCTTCGGTGTCGAAATGAGAAGAAGAGGCACAGGGCTGTGAGGCTTATCTTCACCATCATGATTGTTTATTTTCTCTTCTGGGCTCCCTACAACATTGTCCTTCTCCTGAACACCTTCCAGGAATTCTTTGGCCTGAATAATTGCAGTAGCTCTAACAGGTTGGACCAAGCTATGCAGGTGACAGAGACTCTTGGGATGACGCACTGCTGCATCAACCCCATCATCTATGCCTTTGTCGGGGAGAAGTTCAGAAACTACCTCTTAGTCTTCTTCCAAAAGCACATTGCCAAACGCTTCTGCAAATGCTGTTCTATTTTCCAGCAAGAGGCTCCCGAGCGAGCAAGCTCAGTTTACACCCGATCCACTGGGGAGCAGGAAATATCTGTGGGCTTGTGA

    >Allele02

    ATGGATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACATCGGAGCCCTGCCAAAAAATCAATGTGAAGCAAATCGCAGCCCGCCTCCTGCCTCCGCTCTACTCACTGGTGTTCATCTTTGGTTTTGTGGGCAACATGCTGGTCATCCTCATCCTGATAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTCAACCTGGCCATCTCTGACCTGTTTTTCCTTCTTACTGTCCCCTTCTGGGCTCACTATGCTGCCGCCCAGTGGGACTTTGGAAATACAATGTGTCAACTCTTGACAGGGCTCTATTTTATAGGCTTCTTCTCTGGAATCTTCTTCATCATCCTCCTGACAATCGATAGGTACCTGGCTGTCGTCCATGCTGTGTTTGCTTTAAAAGCCAGGACGGTCACCTTTGGGGTGGTGACAAGTGTGATCACTTGGGTGGTGGCTGTGTTTGCGTCTCTCCCAGGAATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTCTCATTTTCCATACATTAAAGATAGTCATCTTGGGGCTGGTCCTGCCGCTGCTTGTCATGGTCATCTGCTACTCGGGAATCCTAAAAACTCTGCTTCGGTGTCGAAATGAGAAGAAGAGGCACAGGGCTGTGAGGCTTATCTTCACCATCATGATTGTTTATTTTCTCTTCTGGGCTCCCTACAACATTGTCCTTCTCCTGAACACCTTCCAGGAATTCTTTGGCCTGAATAATTGCAGTAGCTCTAACAGGTTGGACCAAGCTATGCAGGTGACAGAGACTCTTGGGATGACGCACTGCTGCATCAACCCCATCATCTATGCCTTTGTCGGGGAGAAGTTCAGAAACTACCTCTTAGTCTTCTTCCAAAAGCACATTGCCAAACGCTTCTGCAAATGCTGTTCTATTTTCCAGCAAGAGGCTCCCGAGCGAGCAAGCTCAGTTTACACCCGATCCACTGGGGAGCAGGAAATATCTGTGGGCTTGTGA

    1. Examine the two DNA sequences and determine whether mRNA from each is likely to be translated into a polypeptide, assuming transcription followed by appropriate post-transcriptional processing occurred. Explain your answer.

    2 AnswersBiology1 decade ago
  • Team Work- why do we need?

    Explain why effective team work is essential for success in science, medicine, business, parenting, etc.

    2 AnswersOther - Society & Culture1 decade ago
  • Team Work- why do we need?

    Explain why effective team work is essential for success in science, medicine, business, parenting, etc.

    6 AnswersCricket1 decade ago
  • Scientifically hard questions-global warming and mental health?

    Why is it difficult to produce scientifically valid answers to complex problems, such as mental health or global warming? (In your answer, include an explanation of the nature of science. Relate that explanation to your answer.)

    1 AnswerOther - Science1 decade ago
  • humans and photosynthesis..evolution!?

    Explain, in evolutionary terms, why animals (including humans) dont have the ability to synthesize all the amino acids necessary for protein synthesis.

    4 AnswersBiology1 decade ago
  • IR spectrum of PETE polymer..will give you a BEST ANSWER?

    Identify the two DIFFERENT carbonyl groups, and explain why they the stretches are different

    Here is the structure of the PET polymer:

    http://upload.wikimedia.org/wikipedia/commons/arch...

    And here is the IR spectrum: (it's the first one A. Polyethylene terephthalate (PETE, recycling #1) ..thanks

    http://images.google.com/imgres?imgurl=http://www....

    1 AnswerChemistry1 decade ago
  • O Chem Lab Question..PLEASE help..will give you Best Answer?

    If we were forming 1,2,3,4 tetraphenylnaphthalene by Diels-Alder reaction, and using tetraphenylcyclopentadienone as diene and benzyne as dienophile...we would make benzyne from anthranilic acid and isoamyl nitrite...

    My question is what could go wrong if too much anthranilic acid was added?

    Refer to this experiement:

    http://www.cerlabs.com/experiments/10534977766.pdf

    THANKS A LOT...I appreicate your time and effort.

    1 AnswerChemistry1 decade ago
  • What's the opposite of Friedel Crafts?

    How do you remove the "R" group that could be added by Friedel Crafts?

    1 AnswerChemistry1 decade ago
  • Machinery/Technology in Dental Office?

    What kind of technology or machinery is used in the dental office for basic procedures (such as fillings,cleaning, extractions, crowns, bridgework, dentures, etc..)

    If you're familiar with any of them, please let me knowww....

    Will give you a Best Answer ...thanks

    2 AnswersDental1 decade ago
  • Organic Chemistry Mechanism..Will give you a Best Answer?

    Draw a mechanism of phenylmagnesium bromide reacting with product. The product is benzene.

    Just explain me in words since you can't really draw...how the mechanism works

    Thanks

    2 AnswersChemistry1 decade ago
  • Ethical Issues raised by technology..PLEASE HELP..WIl give you a BEST ANSWER?

    Technology has important influences on the working lives of many people. What are the most important ethical issues raised by the ways technologies affect work?

    Please give three examples.

    5 AnswersPhilosophy1 decade ago
  • Redox reacrtion--PLEASE HELP--will give you a best answer?

    2.

    An electrochemical cell is constructed. For the two standard reduction half-reactions and potentials given below, determine the balanced spontaneous REDOX reaction and expected cell potential, Eocell, for this cell.

    Au3+ + 3e- ===> Au, 1.50 V

    Ag+ + e- ===> Ag, 0.80 V

    In the three boxes below, write the numerical value for Eocell (to the nearest 0.01 V, omitting the "V") in box 1, the number of electrons tranferred in the balanced cell reaction as an integer in box 2, and the chemical symbol for the element that forms at the cathode in box 3.

    1.

    2.

    3.

    1 AnswerChemistry1 decade ago
  • Strongest reducing agent?? will give you a best answer?

    1.

    Standard Reduction Potentials at 25°C for some Half-Reactions in Aqueous Solution

    Half-Reaction Eored(V)

    Au3+(aq) + 3e- ====> Au(s) 1.50

    Ag+(aq) + e- ====> Ag(s) 0.80

    Cu2+(aq) + 2e- ====> Cu(s) 0.34

    2H+(aq) + 2e- ====> H2(g) 0.00

    Pb2+(aq) + 2e- ====> Pb(s) -0.13

    Cd2+(aq) + 2e- ====> Cd(s) -0.40

    Zn2+(aq) + 2e- ====> Zn(s) -0.76

    Al3+(aq) + 3e- ====> Al(s) -1.66

    Of the following two species, which is the strongest reducing agent under aqueous conditions at standard conditions (All concentrations are 1 M at 1 atm)? Use the table of standard reduction potentials above.

    1. Au(s)

    2. Al(s)

    1 AnswerChemistry1 decade ago
  • Why Salt Bridge??

    What is the purpose of the salt bridge in an electrochemical cell?

    1. The salt bridge is a metallic stand that supports the cell.

    2. The salt bridge is another name for the standard hydrogen electrode, thus it permits the other half-reaction potential to be measured.

    3. The salt bridge contains a salt (positive and negative ions) which can migrate into the cell compartments to preserve electrical neutrality in each half-reaction compartment as the cell runs spontaneously.

    4. The salt bridge contains the positive and negative cell electrodes, thus permitting the Ecell to be measured.

    5. The salt bridge is a wire that permits electrons to flow between the cell compartments.

    2 AnswersChemistry1 decade ago
  • Easy Multiple Choice ques...will give you a best answer if correct?

    Explain the answer too..thanks

    The following electrochemical (galvanic) cell is constructed as given by the line notation:

    Zn(s) | Zn2+(aq),1M || Cu2+(aq),1M | Cu(s)

    (If you do not know what the line notation means, read about in the lab manual and/or text)

    The Ecell measured for this cell is 1.10 V. Note that the concentrations of Zn2+(aq) and Cu2+(aq) are both 1M (standard conditions). Will the value of Ecell increase, decrease, or remain the same if the amount of Zn(s) metal in the anode is increased?

    1. Increase

    2. Decrease

    3. Remain the same

    2 AnswersChemistry1 decade ago
  • EASY Oxidizing Agent Question--Will give you best answer if correct...?

    1. Also, explain why?.....

    Standard Reduction Potentials at 25°C for some Half-Reactions in Aqueous Solution

    Half-Reaction Eored(V)

    Au3+(aq) + 3e- ====> Au(s) 1.50

    Ag+(aq) + e- ====> Ag(s) 0.80

    Cu2+(aq) + 2e- ====> Cu(s) 0.34

    2H+(aq) + 2e- ====> H2(g) 0.00

    Pb2+(aq) + 2e- ====> Pb(s) -0.13

    Cd2+(aq) + 2e- ====> Cd(s) -0.40

    Zn2+(aq) + 2e- ====> Zn(s) -0.76

    Al3+(aq) + 3e- ====> Al(s) -1.66

    Of the following two species, which is the strongest oxidizing agent under aqueous conditions at standard conditions (All concentrations are 1 M at 1 atm)? Use the table of standard reduction potentials above.

    1. H+(aq)

    2. Zn2+(aq)

    3 AnswersChemistry1 decade ago
  • Chemical Properties of Aluminum---Will give you BEST ANSWER?

    Question Details:

    Can someone tell me the following things for Aluminum:

    Chemical Formula/ Structure & Properties

    Complete description of the structure & properties of the chemical. Include relevant reaction

    2 AnswersChemistry1 decade ago
  • Science a guidance for ethics??

    Does science give guidance for ethics?? What do you think?

    Give specific examples for evolutionary history if you know any

    2 AnswersOther - Society & Culture1 decade ago