Hello

Photosynthesis involves multiple electron transfers. What is the ultimate source of electron supplied to the photosynthesis reaction? Describe the reaction that occurs to obtain these electrons.

A mixture contains 10.0 g each of the three gases nitrogen, oxygen, and argon. What is the mole fraction of nitrogen in the mixture?

please help!

What are two things that DNA replication and Gene Expression have in common?

From a DNA sequence, explain how a Gene goes from being DNA to expression as a protein.

I think it's asking to start replication from the leading strand, then the lagging strand/okazaki fragment, followed by transcription.

I just need to know if I am on the right track or if I am missing anything. Thank you!

I am studying for an exam and unsure what this question is asking. I think I have to write the compliment of the template given but I'm not sure. Please help!

This is the Template strand of DNA:

(Promoter->)AAGCTTACGGACAGCCTATTGCTCCTAGGACCATCAT

What is the pre-mRNA sequence that is made from this DNA?

I had a total of 30 quotes, I got most of them please help me with the remaining ones, even if you cant answer all just a few i would appreciate it. thank you so so so much

1. "These laborers, who must sell themselves piecemeal, are a commodity, like every other article of commerce.”

2. "The proletarian movement is the self-conscious, independent movement of the immense majority, in the interests of the immense majority.”

3. “What the bourgeoisie, therefore, produces, above all, is its own gravediggers.”

4. Capital is, therefore, not a personal, it is a social power

5. Abolition of the family! Even the most radical flare up at this infamous proposal of the communists.”

6. “…we shall have an association in which the free development of each is the condition for the free development of all.”

7. “Christian socialism is but the holy water with which the priest consecrates the heartburnings of the aristocrat.”

d some help understanding these quotes-- please the meaning of these quotes as pertaining to Marx's thoughts and concepts

Our epoch, the epoch of the bourgeoisie, possesses, however, this distinctive feature: it has simplified the class antagonisms.”

“All that is solid melts into air, all that is holy is profaned, and man is at last compelled to face with sober senses his real conditions of life and his relations with his kind.”

“The distinguishing feature of communism is not the abolition of property generally, but the abolition of bourgeois property.”

thank you for the help

I got into a car accident and had some starches and dents fixed recently and the guy put wax on the car after painting it and said to take it off after a few days I tried to wash it off and it won't come off what do I do?!!!

I recently bought a 13 inch macbook pro and I already have an iPhone. I am trying to sync my iCal on my Macbook to my iPhone, can someone tell me what/how do I do that?

What are Martha Graham's and Katherine Dunham's technical contributions to modern dance? Name the two.

I want to buy a Mac and I don't know which one to get. So help with that?

Also, why do ghz matter in computers? What does it have to do with anything?

catholicism/protestantism: How did these religious influences effect the dance forms of African slaves? How did these dance forms evolve into revolutionary social change in each society?

List the metals in order of decreasing activity. Use the symbol >

metals: Al, Mg, Cu, Zn, Fe

Which metal is more active, iron or copper? How so?

I have to write a chemical equation for my chemistry lab. I put Iron and Copper into an Iron (III) Nitrate solution. The Iron formed a small ring of rust on it and the copper turned totally black like charcoal on the surface. How would I write the equation? I have no idea. The question says "Write a chemical equation based on what you observed when the metal strips were immersed in soultions of iron(iii).

Thank you so much for the help!

4.) Know the difference between covalent and hydrogen bonds.

a. How are they formed?

b. What is their relative strength?

c. Give an example of each.

d. Which kind of bond gives water its many unique qualities?

How would the addition of an oxygenated environment change the outcome of the Miller-Urey experiment?

A concrete pile has the dimensions 14 inchesx14 inchesx15 feet.

a.) What is the surface area expressed in square feet of one pile, exclude ends

b.) Determine the total surface area expressed in sq meters, of the pile, including ends.

c.) How many cubic meters of concrete were used to make the pile.

I had a to go to a sex toy store for my sex ed class but when I told my mom to take me she refused and said that we can't go :/ I have to write a paper on the wildest things I saw there and I don't know what to write... can someone PLEASE help me :/