Yahoo Answers is shutting down on May 4th, 2021 (Eastern Time) and beginning April 20th, 2021 (Eastern Time) the Yahoo Answers website will be in read-only mode. There will be no changes to other Yahoo properties or services, or your Yahoo account. You can find more information about the Yahoo Answers shutdown and how to download your data on this help page.
Hello
Photosynthesis multiple electron transfer?
Photosynthesis involves multiple electron transfers. What is the ultimate source of electron supplied to the photosynthesis reaction? Describe the reaction that occurs to obtain these electrons.
2 AnswersBiology8 years agoA mixture contains 10.0 g each of the three gases nitrogen, oxygen, and argon.?
A mixture contains 10.0 g each of the three gases nitrogen, oxygen, and argon. What is the mole fraction of nitrogen in the mixture?
please help!
1 AnswerChemistry8 years agoWhat are two things that DNA replication and Gene Expression have in common?
What are two things that DNA replication and Gene Expression have in common?
2 AnswersBiology8 years agoDNA sequence to protein?
From a DNA sequence, explain how a Gene goes from being DNA to expression as a protein.
I think it's asking to start replication from the leading strand, then the lagging strand/okazaki fragment, followed by transcription.
I just need to know if I am on the right track or if I am missing anything. Thank you!
2 AnswersBiology8 years agoTemplate DNA strand please help!?
I am studying for an exam and unsure what this question is asking. I think I have to write the compliment of the template given but I'm not sure. Please help!
This is the Template strand of DNA:
(Promoter->)AAGCTTACGGACAGCCTATTGCTCCTAGGACCATCAT
What is the pre-mRNA sequence that is made from this DNA?
2 AnswersBiology8 years agoCommunist Manifesto quotes please help!?
I had a total of 30 quotes, I got most of them please help me with the remaining ones, even if you cant answer all just a few i would appreciate it. thank you so so so much
1. "These laborers, who must sell themselves piecemeal, are a commodity, like every other article of commerce.”
2. "The proletarian movement is the self-conscious, independent movement of the immense majority, in the interests of the immense majority.”
3. “What the bourgeoisie, therefore, produces, above all, is its own gravediggers.”
4. Capital is, therefore, not a personal, it is a social power
5. Abolition of the family! Even the most radical flare up at this infamous proposal of the communists.”
6. “…we shall have an association in which the free development of each is the condition for the free development of all.”
7. “Christian socialism is but the holy water with which the priest consecrates the heartburnings of the aristocrat.”
2 AnswersPolitics8 years agoKarl Marz the communist manifesto quotes please help!?
d some help understanding these quotes-- please the meaning of these quotes as pertaining to Marx's thoughts and concepts
Our epoch, the epoch of the bourgeoisie, possesses, however, this distinctive feature: it has simplified the class antagonisms.”
“All that is solid melts into air, all that is holy is profaned, and man is at last compelled to face with sober senses his real conditions of life and his relations with his kind.”
“The distinguishing feature of communism is not the abolition of property generally, but the abolition of bourgeois property.”
thank you for the help
6 AnswersPolitics8 years agoCar wax won't come off? Please help?
I got into a car accident and had some starches and dents fixed recently and the guy put wax on the car after painting it and said to take it off after a few days I tried to wash it off and it won't come off what do I do?!!!
4 AnswersMaintenance & Repairs8 years agoMacbook Pro, iCal, iPhone?
I recently bought a 13 inch macbook pro and I already have an iPhone. I am trying to sync my iCal on my Macbook to my iPhone, can someone tell me what/how do I do that?
1 AnswerOther - Computers9 years agoModern Ballet Dance questions PLEASE HELP?
What are Martha Graham's and Katherine Dunham's technical contributions to modern dance? Name the two.
1 AnswerDancing9 years agoMacBook Air vs MacBook Pro?
I want to buy a Mac and I don't know which one to get. So help with that?
Also, why do ghz matter in computers? What does it have to do with anything?
1 AnswerLaptops & Notebooks10 years agoafrican american slave dance and religion?
catholicism/protestantism: How did these religious influences effect the dance forms of African slaves? How did these dance forms evolve into revolutionary social change in each society?
3 AnswersReligion & Spirituality10 years agoreactivity questions please help?
List the metals in order of decreasing activity. Use the symbol >
metals: Al, Mg, Cu, Zn, Fe
1 AnswerChemistry10 years agochemistry help please? reducing agents?
Which metal is more active, iron or copper? How so?
1 AnswerChemistry10 years agowriting chemical equations?
I have to write a chemical equation for my chemistry lab. I put Iron and Copper into an Iron (III) Nitrate solution. The Iron formed a small ring of rust on it and the copper turned totally black like charcoal on the surface. How would I write the equation? I have no idea. The question says "Write a chemical equation based on what you observed when the metal strips were immersed in soultions of iron(iii).
Thank you so much for the help!
1 AnswerChemistry10 years agocovalent and hydrogen bonds?
4.) Know the difference between covalent and hydrogen bonds.
a. How are they formed?
b. What is their relative strength?
c. Give an example of each.
d. Which kind of bond gives water its many unique qualities?
3 AnswersBiology10 years agoBio help Miller-Urey experiment?
How would the addition of an oxygenated environment change the outcome of the Miller-Urey experiment?
2 AnswersOther - Science10 years agoSurface area help please.?
A concrete pile has the dimensions 14 inchesx14 inchesx15 feet.
a.) What is the surface area expressed in square feet of one pile, exclude ends
b.) Determine the total surface area expressed in sq meters, of the pile, including ends.
c.) How many cubic meters of concrete were used to make the pile.
1 AnswerMathematics10 years agoWhat is the wildest thing you have seen at a sex toy shop?
I had a to go to a sex toy store for my sex ed class but when I told my mom to take me she refused and said that we can't go :/ I have to write a paper on the wildest things I saw there and I don't know what to write... can someone PLEASE help me :/
2 AnswersLesbian, Gay, Bisexual, and Transgender10 years ago