<3

My microbiology class has recently been going over metabolism and I have been trying to understand all of the metabolisms and have been struggling. I need someone to please explain a few of the questions that I need to answer. Thank you in advance for your help!

How many AA (amino acids) will be in this protein before post translational modification?

5' UGAGUAGGACAUGCUAAAAACAACUCUUGAAUGAAGUAG 3'

If you are producing a protein that has 73 amino acids, how many ATP/GTP will be used to bring amino acids into the A site of the ribosome during elongation?

What would the sequence of the first two amino acids in protein produced by this mRNA be (before post translational modification)?

5' UGCCCAGGACAUGGAUCGAGCCAAUAAGUAAGUAGCGAG 3'

You isolate a bacterium that reduced NO2- while oxidizing amino acids, what type of metabolism could this be? (I am assuming this is an anaerobic metabolism)

1. Aerobic Respiration

2. Anaerobic Respiration

3. Aerobic Chemolithotropy

4. Anaerobic Chemolithotrophy

(It can be more than one of these as well)

I'm still trying to understand how to do integration and need help with one of my homework problems. The problem to integrate x^5(x^6-1)^15dx by substitution where u=x^6-1. I would be very appreciative if someone could explain how to do this problem.

I have been trying to figure out my integration problem for awhile now and have had no luck:( I would be very appreciative if somebody could explain to me how to do it.

The problem is integrate dx/(3x+2)^4 by substitution where u=3x+2

Thank you in advance!

I am looking for some new music to listen to and would appreciate some recommendations. I am mainly into rock and alternative genres of music, but I am willing to try other genres. Recommendations can be specifics songs or artists in general. Thanks in advance!

My favorite quote is "You never know how strong you are until being strong is the only choice you have."

What is the song and how has it influenced your life?

My uncle offered me a chance to buy his 91' I Rock Camaro. My mom told me I could get it, but I was wondering what are some good cars for 16 year olds?

http://i373.photobucket.com/albums/oo175/maceymay0...

http://i373.photobucket.com/albums/oo175/maceymay0...

Thanks!

I want stores besides hollister, abercrombie and american eagle.

The experiment is comparing 3 different light bulbs. G.E. brand, Philips brand and a generic brand. What would the dependent variable and control be?

Which outfit or the first day of school?

First Outfit:

http://www.polyvore.com/cgi/set?id=3385094

or

Second Outfit:

http://www.polyvore.com/cgi/set?id=2920681

or

Third Outfit:

A white knit with a white cami under and the jeans in the other outfits with the flip flops in the other outfit

http://www.polyvore.com/cgi/set?id=2920681

What do you think of this outfit for the first day of school?

Which outfit do you like the best?

First Two:

http://www.polyvore.com/cgi/set?id=1241835

Third One:

http://www.polyvore.com/cgi/set?id=1205026

Thanks!

Mine is Big Girls Don't Cry right now.