Yahoo Answers is shutting down on May 4th, 2021 (Eastern Time) and beginning April 20th, 2021 (Eastern Time) the Yahoo Answers website will be in read-only mode. There will be no changes to other Yahoo properties or services, or your Yahoo account. You can find more information about the Yahoo Answers shutdown and how to download your data on this help page.

<3
Best Program To Learn Korean?
1 AnswerLanguages3 years agoAnyone Willing To Help Me With Microbiology?
My microbiology class has recently been going over metabolism and I have been trying to understand all of the metabolisms and have been struggling. I need someone to please explain a few of the questions that I need to answer. Thank you in advance for your help!
How many AA (amino acids) will be in this protein before post translational modification?
5' UGAGUAGGACAUGCUAAAAACAACUCUUGAAUGAAGUAG 3'
If you are producing a protein that has 73 amino acids, how many ATP/GTP will be used to bring amino acids into the A site of the ribosome during elongation?
What would the sequence of the first two amino acids in protein produced by this mRNA be (before post translational modification)?
5' UGCCCAGGACAUGGAUCGAGCCAAUAAGUAAGUAGCGAG 3'
You isolate a bacterium that reduced NO2- while oxidizing amino acids, what type of metabolism could this be? (I am assuming this is an anaerobic metabolism)
1. Aerobic Respiration
2. Anaerobic Respiration
3. Aerobic Chemolithotropy
4. Anaerobic Chemolithotrophy
(It can be more than one of these as well)
1 AnswerHomework Help8 years agoHelp With Integration By Substitution?
I'm still trying to understand how to do integration and need help with one of my homework problems. The problem to integrate x^5(x^6-1)^15dx by substitution where u=x^6-1. I would be very appreciative if someone could explain how to do this problem.
2 AnswersHomework Help8 years agoHelp With Integration By Substitution?
I have been trying to figure out my integration problem for awhile now and have had no luck:( I would be very appreciative if somebody could explain to me how to do it.
The problem is integrate dx/(3x+2)^4 by substitution where u=3x+2
Thank you in advance!
1 AnswerMathematics8 years agoMusic Recommendations?
I am looking for some new music to listen to and would appreciate some recommendations. I am mainly into rock and alternative genres of music, but I am willing to try other genres. Recommendations can be specifics songs or artists in general. Thanks in advance!
8 AnswersAdolescent8 years agoWhat is your favorite quote?
17 AnswersAdolescent1 decade agoWhat is your dream job?
11 AnswersAdolescent1 decade agoWhat are some books you would recommend for young adults?
10 AnswersBooks & Authors1 decade agoWhat is your favorite quote?
My favorite quote is "You never know how strong you are until being strong is the only choice you have."
21 AnswersAdolescent1 decade agoWhat is your favorite quote?
36 AnswersAdolescent1 decade agoWhat are some songs that have influenced your life?
What is the song and how has it influenced your life?
17 AnswersAdolescent1 decade agoWhat is a good car for a 16 year old?
My uncle offered me a chance to buy his 91' I Rock Camaro. My mom told me I could get it, but I was wondering what are some good cars for 16 year olds?
10 AnswersOther - Cars & Transportation1 decade agoWhere are some good clothing stores for teens to shop at?
I want stores besides hollister, abercrombie and american eagle.
10 AnswersFashion & Accessories1 decade agoDo all elements have radioisotopes?
1 AnswerChemistry1 decade agoWhat is the dependent variable and control in this experiment?
The experiment is comparing 3 different light bulbs. G.E. brand, Philips brand and a generic brand. What would the dependent variable and control be?
5 AnswersChemistry1 decade agoWhich outfit for the first day of school?
Which outfit or the first day of school?
First Outfit:
http://www.polyvore.com/cgi/set?id=3385094
or
Second Outfit:
http://www.polyvore.com/cgi/set?id=2920681
or
Third Outfit:
A white knit with a white cami under and the jeans in the other outfits with the flip flops in the other outfit
23 AnswersFashion & Accessories1 decade agoFirst Day of School Outfit?
http://www.polyvore.com/cgi/set?id=2920681
What do you think of this outfit for the first day of school?
13 AnswersFashion & Accessories1 decade agoOutfit help?
Which outfit do you like the best?
First Two:
http://www.polyvore.com/cgi/set?id=1241835
Third One:
http://www.polyvore.com/cgi/set?id=1205026
Thanks!
5 AnswersFashion & Accessories1 decade agoWhat song describes your life?
Mine is Big Girls Don't Cry right now.
4 AnswersOther - Music1 decade ago
