Yahoo Answers is shutting down on May 4th, 2021 (Eastern Time) and beginning April 20th, 2021 (Eastern Time) the Yahoo Answers website will be in read-only mode. There will be no changes to other Yahoo properties or services, or your Yahoo account. You can find more information about the Yahoo Answers shutdown and how to download your data on this help page.

Trending News

Promoted
Sydney
Sydney asked in Science & MathematicsBiology · 1 day ago

Biology help ASAP ?

Use the following polypeptide chain to construct a possible nucleotide sequence for the DNA molecule that could code for it. 

met-lay-asp-val-leu-phe-trp-pro-arg-cys-his-ser 

1 Answer

Relevance
  • hcbiochem
    Lv 7
    1 day ago

    There will be many possible answers because of the degeneracy of the genetic code. The easiest approach is to find a genetic code table that uses DNA codons rather than RNA codons.  I found one here: https://www.chemguide.co.uk/organicprops/aminoacid...

    Note: I'm not sure what "lay" is...That is not a standard amino acid. So, I'll just put xxx for that codon.

    met-lay-asp-val-leu-phe-trp-pro-arg-cys-his-ser

    ATGxxxGACGTACTTTTTTGGCCCCGGTGTCATTCA

Still have questions? Get your answers by asking now.