Yahoo Answers is shutting down on May 4th, 2021 (Eastern Time) and beginning April 20th, 2021 (Eastern Time) the Yahoo Answers website will be in read-only mode. There will be no changes to other Yahoo properties or services, or your Yahoo account. You can find more information about the Yahoo Answers shutdown and how to download your data on this help page.
Trending News
Biology help ASAP ?
Use the following polypeptide chain to construct a possible nucleotide sequence for the DNA molecule that could code for it.
met-lay-asp-val-leu-phe-trp-pro-arg-cys-his-ser
1 Answer
- hcbiochemLv 71 day ago
There will be many possible answers because of the degeneracy of the genetic code. The easiest approach is to find a genetic code table that uses DNA codons rather than RNA codons. I found one here: https://www.chemguide.co.uk/organicprops/aminoacid...
Note: I'm not sure what "lay" is...That is not a standard amino acid. So, I'll just put xxx for that codon.
met-lay-asp-val-leu-phe-trp-pro-arg-cys-his-ser
ATGxxxGACGTACTTTTTTGGCCCCGGTGTCATTCA

