Yahoo Answers is shutting down on May 4th, 2021 (Eastern Time) and beginning April 20th, 2021 (Eastern Time) the Yahoo Answers website will be in read-only mode. There will be no changes to other Yahoo properties or services, or your Yahoo account. You can find more information about the Yahoo Answers shutdown and how to download your data on this help page.
Trending News
Look at the strand of DNA below and answer the following questions: ?
5’ACGATGCCGTATCGTCCACGTAGCCTTTAACAC3’
a) Based on standard writing conventions, is this a coding or template strand of DNA?
template strand
b) What is the sequence of the complementary DNA strand?
AGCTACGGCATAGCAGGTGCATCGGAAATTGTG
c) What is the sequence of the transcript?
d) What would the resulting amino acid sequence be if the transcript was translated (the genetic code is below)? Label the N (amino) & C (carboxyl) terminus of the polypeptide.
e) Near the end of the sequence, there is the following sequence: CTTT. Determine the effects of each of the mutations listed below, whether or not the peptide produced will be the same as the wild type, and give two descriptive names for each mutation.
CTTT --> CCTTT
CTTT --> TTT
CTTT --> GTTT

Be the first to answer this question.

