Tifanie

I am working on a DNA assignment and here is the question I need help with. If you could just explain what they mean and give an example 10 pts easily

Heres the question:

4. Since we know that the process of DNA fingerprinting will cause the restriction fragments in each sample to separate according to size, count the number of bases in each fragment and fill in the chart on page 2 by copy/pasting each fragment into the correct cell.

These DNA sequences go with it:

Mary

CCTAGACGGCCAGGCACAAGCCAGGCCATGGCCACATCAGTTAGACCGAGGCCGAATCGGCCTTATTGCAGG

Joe

CCGAGGCCAGGGTATACCGGTATAGGCCAATTTGGCCGGCATGGGCCGATACAGCCGATGGCCATATAGGGGG

Dan

CCGGTACATTACCAGGCCAAGGATACGGCAAGCAGGCCTTCATGGCCAAGGCCTTAGCACGGGCCAATGACGG

Baby Jakob

CCACATCAGTTAGACCGAGGCCAAGGCCAACCGACGGCAAGGCCCGACAGGCCAAAGACGGCCATATAGGGGG

And they gave me this chart:

Bases Mary Joe Dan Baby Jakob

5

6

7

8

9

10

11

12

13

14

15

16

17

18

19

20

I live in Florida and now that I am financially secure I wanted to move out because my mom never really gives me a choice. She is constantly putting me down and I am always depressed and I don't want to feel that was so my best friend is going to college and we were going to get a place together and I trust him so I was looking for places and she told me that she would throw me in Juvenile if I tried to move out. Can she do this?

I haven't gotten answers so I am reposting: Over the past month or so I've lost 10 pounds without trying. People notice and yet I still don't. I get sick when I eat. Now, after I use the restroom, there's spots of a deep red blood that equal to about the size of a quarter. This is only the second time its happened but its from my bottom not my front. Last time was about two weeks ago and second time was tonight. I am not on my cycle and wasn't either time but its not when I wipe my front, only my bottom. I have pretty bad cramps, kind of like when I am on my menstrual cycle and right now I am nauseous and have lost and have loss of appetite for the last couple days. Before that I ate so much and was losing weight anyways. Now, I will start eating something and have a full feeling as soon as it starts. I don't understand what's going on with my body but I'm hurting and tired. I told my mom the last time I saw blood and it didn't phase her. Am I overreacting? Will I be okay until I can convince someone to take me to the doctor? Do I even need to go?

Over the past month or so I've lost 10 pounds without trying. People notice and yet I still don't. I get sick when I eat. Now, after I use the restroom, there's spots of a deep red blood that equal to about the size of a quarter. This is only the second time its happened but its from my bottom not my front. Last time was about two weeks ago and second time was tonight. I am not on my cycle and wasn't either time but its not when I wipe my front, only my bottom. I have pretty bad cramps, kind of like when I am on my menstrual cycle and right now I am nauseous and have lost and have loss of appetite for the last couple days. Before that I ate so much and was losing weight anyways. Now, I will start eating something and have a full feeling as soon as it starts. I don't understand what's going on with my body but I'm hurting and tired. I told my mom the last time I saw blood and it didn't phase her. Am I overreacting? Will I be okay until I can convince someone to take me to the doctor? Do I even need to go?

I found out today I am not pregnant so I decided I wanted to keep track of what I do and what I eat in a journal to live a healthier lifestyle and hopefully in turn, lose weight. Today I only had like 500 calories but if I eat more I will not feel good. I promise I don't have an eating disorder. Today I had black eyed peas for brunch (i know its weird for that time) lol. Anyways, thats where most my calories came from then I had a salad for dinner with baby spinach leaves, a green apple, dried cranberries, and a balsamic spritz dressing. Then for a snack I had a peach and I am so full. This all equaled to a little under 500 calories and I know this isn't good. What do you recommend. I weigh 147 and I am 5' 3" so I am overweight. But yet I don't even eat that much so my doctor tested me for thyroid and it came back good so I am not understanding. Any opinions?

I am sure that having a pregnancy test at the doctors office is more accurate than a typical home pregnancy test but if i were to take a urine test and a blood test at the doctors office... which is more accurate and can you detect pregnancy earlier in a urine test vs a blood test or do they both detect at the same time. For instance, my period isnt due until the 18th and i think i may be pregnant, would they be able to detect pregnancy already if i went to them or do i still have to wait until i miss a period?

I had initially protected sex on September 24th which was the last day of my period. At the very end, the guy told me the condom broke and that its possible I'd be pregnant. Well, I wasn't worried because it was the 5th day of my period and I figured I wouldn't get pregnant. However, I started ovulating 4 days earlier than I should have which means I had sex 5 days before ovulating which from what I understand, puts me at risk for pregnancy. Is this true? So now, I have been cramping really bad and its only been a week and a half since sex. Can this be a sign of pregnancy or something else? What are the odds I could be pregnant. Me and a friend are going to take a test around the 18th. So I am just passing time until then.

Well, I am really needed to start my account on freecycle.org but can't start posting because I do not belong to any groups. How do I know what groups are in my area?

Before I was born, my mom gave away a sister of mine and all I dream about is finding her before my 16th birthday. However, I don't have money. But I was wondering how I could find her. Does anyone know?

Thank you for the help. If you need more details just ask or you could even email me at tifaniecrenshaw@aol.com or write me on myspace at www.myspace.com/sayitandmeanit

Are there any songs out there about two people loving each other but aren't allowed to be together specifically due to the age difference? Or anything kind of like it?

No country or rap please.

Or it can even be about waiting til the time is right but not wanting to.

What is a song that says that you are so happy to have your boyfriend or girlfriend and that no matter what you hope that you are together forever? And that without them you'd be lost or that you wouldn't be able to go on. I don't know. Something like that.

I don't want to say I love him because thats hard for me to say but I don't want to lose him because of my mental issues with those words.

Lately I have been experiency common pregnancy symptoms. I am always tired no matter how much I sleep and I have had a weird sudden change in appetite. I have experienced an unusual weight gain though I really don't eat much. I am always so nausuated and sometimes I feel a pain in my side or my breasts. My breasts have enlarged and seem a lot fuller. And I've noticed my fingers have swollen because my ring is getting tight. Not to mention a clear discharge occurs very frequently but it is odorless. I can't be pregnant because I have had my period. Does anyone know what might be going on? Thank you in advance. Even a little help is greatly appreciated.

Hey I am no longer having sex as I have decided to recommit and to wait it out until I am atleast older. Lately, I have been having symptoms here and there that would indicate pregnancy. I had a miscarriage a few months ago if that is needed for information.

My breasts have been really sore and I have had a great increase in appetite whereas, usually, I barely ever have an appetite at all. My fingers have swollen though I dont think that is a symptom. And I have been constipated (sorry if TMI). I did have unprotected sex :[ but it was during my period. Its too early to test just yet. Meanwhile, I'd like to know if I should worry about something other than pregnancy.

To be honest, I'm not too worried about it being pregnancy at all and I really don't think I am. I just would like to know what my chances are.

What is the relative location of Jacksonville, Florida? (Relative Terms)

My hair is naturally curly and my mom says she doesn't understand why I straighten it. So do you think my hair looks better straight or curly?

Straight:

http://i45.photobucket.com/albums/f69/Tifanieee/fi...

http://i45.photobucket.com/albums/f69/Tifanieee/IM...

http://i45.photobucket.com/albums/f69/Tifanieee/IM...

Curly:

http://i45.photobucket.com/albums/f69/Tifanieee/IM...

http://i45.photobucket.com/albums/f69/Tifanieee/ne...

And how old do you think I am/ look? :)

I am dizzy. Can barely type this. I feel like I may pass out really soon. I'm starting to sweat and it is not hott. This maybe tmi but yesterday me and my bf had sex and i had a tampon in. prob a stupid thing to do. we were in a moment becuase he just came back and stuff. dunno if that has anything to do with anything. dont say i was stupid for doinhg anything i just need help. cant call a doctor becuase my mom cant kniw. i dont know hwat is wrong. anyone have a clue?

Well I have been kind of "friends with benefits" with this guy for 3 months. He moved and was gone for 5 weeks and he just came back and I really don't know if I wanna be just friends with benefits anymore and I would really like to be his girlfriend. The only problem is that I have absolutely no clue if he feels the same way and I don't want to say anything and lose the relationship that we have right now. I know he hangs out with other girls and stuff and maybe he is seeing them too because we made it clear at first that all that didn't matter and I stood on it too because it was fun at first. I really don't know what to say or do without compromising the relationship. He may come back over to see me tonight and he has already been over once today so should I tell him or wait a little while longer for him to get settled in here because he hasnt even been back here a week yet. If you need any other details just ask and check back and I will have this updated. I just need help you know?

Okay well I may be put on birth control soon and to be honest I don't really know all that much about the different types of birth control out there. What are some of the different types of birth control pills? Also, I know that you can gain weight the first year of being put on the pill so do you know any that can prevent weight gain? Thank you. Oh and if age changes anything I am 15. I would like to not hear any judgment. Just suggestions are needed. Thank you!

I would like someone who is trying to lose weight to email me and we encourage each other to lose weight. I am overweight and I hate it and I am dieting and exercising for a new me. The closer to my age the better. I am 153 and 15 and 5' 3". Yeah, I know.. Pretty big. :/ I just need someone to encourage me and help me. It'd also be cool if there were any trainers who could email me and help me as well. This is my dream. Even if you aren't close to my age or weight I still need a buddy. Please and thank you.

Email me at Tiftastic@yahoo.com.

Does anyone know any of the student's full names?