Marissa

What do Catholics believe about Jesus Christ?

What do Catholics believe about how to get to Heaven?

What do Catholics believe about the Bible?

What do they believe about works?

Anything else would be helpful also,

Thanks!

for ages 12-15, its a party at home and there isnt really a specific theme. there will about 20-30 kids. i need good ideas for games. ive heard scavenger hunt, i dont really like that idea and ive heard relay races and i dont really like that either. it should be inside games. thanx for the help :)

has to do with a car or driving.???

besides..

"jesus take the wheel," "highway to hell," or "animals"

an advertisement for an 'Apple iPhone'. it's a school assignment and i have to make an ad. i need something catchy for the headline. something short, sweet and to the point. something directed toward teens preferably. thnx for your help. i could really use it. i have been thinking for days and cant come up with something really good. thnx.

READ THE WHOLE THING AND IF YOU DON'T KNOW WHAT I'M TALKING ABOUT PLEASE DONT RESPOND, THANK YOU!

I want to get a music video from youtube and JUST take the sound and put it in my documents some how and put it in a power point presentation. Not the video, just the sound, if there is'nt a way to do it from a video, can i get a song without the video from another place on the web to put in my presentation, can you try to tell me the whole prossess on how to do all this, if not whatever you know will help.

THNX!!!

..can anyone think of anything good? i just need some ideas. thank you!

i've heard 3 and ive heard 4, i jus wanna know. if u could give me a website that says how many if possible, please.

I know that there are tubes from Cachuma that take the water somewhere, but where? And how do they make it into drinking water? Then where does it go? i'd like to know the whole operation or cycle or whatever..

I know that there are tubes from Cachuma that take the water somewhere, but where? And how do they make it into drinking water? Then where does it go? i'd like to know the whole operation or cycle or whatever..

I'm 5'2", wear a size 12 mostly, squeezed into a 10 yesterday, and I weigh almost 200 pounds. I do have a large chest, that contributes and I know I have muscle. I've had 4 kids and I'm constantly moving all day every day.

I am trying to rescue this dog from the pound. It is super hot outside so It'd be a little hard to do yard work, I don't want to earn money online. Not something like a lemonaide stand, mowing lawns, walking dogs, washing cars..I've tried everything like that and so has every other teenager around here. I need a good idea! Also I do babysit, but that can't get me money by the time they put this dog to sleep.

Thank You!

Marissa

*P.S. remember, i'm a young teenager, not old enough to get an actual job. thnx

Reading Genes: Refer to the following nucleic acid:

*5’- ATGCTATCATTGACCTTGAGTTATTAA –3’ i)

Is this a strand of DNA or RNA? How do you know?

ii) If DNA, what is the complementary strand?

iii) If this were the coding strand of a DNA molecule, what would the mRNA sequence be?

iv) If this were the noncoding strand of a DNA molecule, what would the mRNA sequence be?

v) If DNA and a base were inserted at the beginning of the 5’ end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code!)

vi) If DNA and the G were deleted at the asterisk, how would this affect protein synthesis and the resultant protein? (Hint: think about the code!)

vii) What would happen to the reading frame if three bases were inserted/deleted? Why?

How is cell division controlled???

id be cool to have the healing power like claire off the show heroes or invisibility like peter and that other dude.

i do but some dont. if you dont, who is your celeb crush??

honestly how tall do you think corbin is?

how tall is mitchel musso?? does anyone know?

The question is

[A recipe reqires 2.5 cups of juice concentrate for every 4 cups of water. How much Juice is required to fill a 32.5-cup punch bowl?]

I know the answer is 12.5 cups because the book gave me options. but i dont know how to show my work to get to it.