?

Give the conjugated base for HCOOH, HPO4^2- following Bronsted-Lowry acids?

Give the conjugated base for So4^2- , CH3NH2 following Bronsted_lowery bases?

In chemical formulas.

Where do I start? How do I get the answers?? Chemistry is a new language to me 

CH3NH2(aq)+H20(1)<>CH3NH3+(aq)+OH-(aq) = the equation shows the equilibrium in an aqueous soltion of methylamine

What is the conjugated base of HSO3- , in chemical formula?

What is the conjugated acid of HPO 4^2- in chemical formula?

Please help me walk threw these on how to solve them I am very lost 

Help please! How do I find the answers???

1)What is the pKb valve for F-?

Table listed:

acid=HF Ka =6.8x10-^4 base=F- Kb=1.5x10^-11

Please help!

2) Table :

Given that Ka for HCN is 4.9x10^-10 and Kb for NH3 is 1.8x10^-5 caluclate Kb for CN- and Ka for NH4+

Enter the value Kb value for CN - followed by the Kb value for NH4+ , separated by a comma, using two significant figures?

I would like to know what you think , is it ever ok in research for the participants to be decived? For example in a placebo study? What is a research study that bothered you where they were decived?

Im am very stuck on understanding a (grand theory) in PYS and I need help understanding and comparing the 2 largiest... please help me :(

V^2=35-2v what is the solution to the set?

3b(8b+5)=0 what is the solution to the set?

Determine a polynomial that represents the area of the figure the figure is a triangle with the base of m+7n and the height is m-7n

Question the area of the figure can be represented by?

A chemist has 2 solutions of NHO3. One has 40% concentration and the other has a 25% concentration. How many liters of each solution must be mixed to obtain 84 liters of 27% solutiuon?

How much liters of the 40% solution and how many liters of the 25% solution must be mixed to obtain a 27% solution of HNO3

Factor the polynomial by grouping the middle term of an equivalent trinomial has already been written

10s^2+15s+4s+6=

32b^2-20bq+24bq-15q^2

Factor completely

2c^2-7c-14c+49=

3w^2+14w+8

6s^2+29s-42

10c^2-29C+10

Complete the factoring

6a^2+11ab-35b^2=(2a+7b) ( )

I am trying to do a final review and these have me stuck! Can some one please walk me threw how to solve I would greatly greatly apperciate it

What is the difference between an Ionic solid and a molecular solid??

Please help me really understand the difference beyond Basic elementary :)

Thank you

Do volatile liquids have larger or smaller vapor pressure?

Do does solutes effect the vapor pressure or a volatile solvent?

Help please

How do each of these effect stability differently??

Structure

Temperature

Pressure

Help please more than one word I really need to compare and contrast and Im at a loss other than the basics here.

Thank you

What is the difference between a strong electrolyte adn a weak electrolyte? How can collegiate properties be used to distinguish them??

Help please.

Help me define or explain this????

Why is the energy of vaporization for water much grater than its empathy of fusion??

HELP ME PLEASE :(

The normal boling point of methanol is 64.7 C A solution contaning a nonvolated solute dissolved in methanol has a vapor pressure of 710.0 torr at 64.7c what is the mole fraction of meathanol in this solution?

Which solvent,water or carbon tetrachloride,would you choose to disolve each of the following?

A)KrF2

B)SF2

C)SO2

D)CO2

E)MgF2

F)CH2O

G)CH2=CH2

Help please

(8x+2)(3x^2+6x+8)=

(3x+4)(3x^2+2x+2)=

(2x-2)(2x^5-5x^4+5x^3+x^2-4x+3)=

(5t^2-t-7)(6t^2+5t-1)=

Use the rectangle method to find the product for (x+2)(x+3)?

^ and the number means to the exponitent please help me Im stuck on these ones.

Describe or illustrate the molecular orbitals for OH-. Determine the bond order and indicate weather the molecule is likely to form. Indicate weather the molecule is para or diamagnetic. Write the molecular formula configuration use the molecular orbital energy diagram?

I am very very lost please help :(

a pharmacist wishes to add a solution that is 6% mindoxidil.she has on have80 ml of a 2% solution and addes some 8% solutin to make a 6% olution for much 8% did she add

help please :( :(

if the rna code is this aaaugcccuuaaucucagagu 5'-3' prime

would the mRNA code be

tttacgggaattagagtcgca 3'-5'

and code for

arg,glu,leu,glu,ser but then I have c and a left over from the mRNA code???

help please