innvisible_shadow

I have a 2001 Toyota Echo you can start and let the engine get warm and when you try to accelerate the engine will die just like you shut off the key. You can wait a short time and restart it will run for a short time and die again. Anyone have any ideas what may cause this?

Warning light on dash is flashing with a picture of a battery showing up but the battery is fully charged and the guage shows that it is charging. What would cause this light to come on?

I have a 1986 Venture Royale. On the left handlebar control there is a red button that says PPT. Does anyone know what this button is for?

Can anyone tell me what activates the air compressor for the suspension on a 1986 Venture Royale?

I have a 1986 Yamaha Venture Royale. It runs great but when I put it in gear the engine dies. Anybody have a clue as to what might be wrong? Any suggestions are greatly appreciated.

Can someone explain to me how both men and women have the same number of ribs, but God took a rib from Adam to make Eve. Science says that both men and women have 24 ribs, how is this possible. Shouldn't women have 1 more rib than men?

All the organs of the body were having a meeting, trying to decide who was in charge.

The brain said: "I should be in charge, because I run all the body's systems, so without me nothing would happen."

"I should be in charge," said the heart, "because I pump the blood and circulate oxygen all over the body, so without me you'd all waste away."

"I should be in charge," said the stomach, "because I process food and give all of you energy."

"I should be in charge," said the rectum, "because I'm responsible for waste removal."

All the other body parts laughed at the rectum and insulted him, so in a huff, he shut down tight. Within a few days, the brain had a terrible headache, the stomach was bloated, and the blood was toxic. Eventually the other organs gave in. They all agreed that the rectum should be the boss.

The moral of the story?

You don't have to be smart or important to be in charge... just an *sshole

Two men are driving through Texas when they get pulled over by a State Trooper. The cop walks up and taps on the window with his nightstick.

The driver rolls down the window and WHACK, the cop smacks him in the head with the stick. The driver asks, "What the hell was that for?"

The cop answers, "You're in Texas son. When we pull you over, you better have your license ready when we get to your car."

The driver says, "I'm sorry, Officer, I'm not from around here."

The cop runs a check on the guy's license, and he's clean. He gives the guy his license back, walks around to the passenger side, and taps on the window.

The passenger rolls down the window and WHACK, the cop smacks him on the head with the nightstick.

The passenger asks, "What'd you do that for, sir?"

The cop says, "Just making your wish come true."

The passenger asks, "Making what wish come true?"

The cop says, "I know that two miles down the road you're going to say to your buddy, "I wish that asshole would've tried that **** with me!"

What word in the English language can be in the front, middle, & back of 3 different things? It's the same word but can be in the front, the middle, or the back of 3 different things.

10 points whoever gets it.

Two hillbillies were sitting around talking one afternoon. After a while the first fellow says to the second, "If'n I was to sneak over to your place Saturday and make love to your wife while you was off huntin', and she got pregnant and had a baby, would that make us kin?" The second fellow crooked his head sideways for a minute, scratched his head, and squinted his eyes like he was thinking real hard about the question. Finally, he said, "Well, I don't know about kin, but it would make us even.

What would be the most wild and crazy gift you could give someone for Christmas?

Sven and Ole worked together and both were laid off, so off they went to the unemployment office. Asked his occupation, Ole said, 'Panty stitcher. I sew the elastic onto cotton panties.' The clerk looked up panty stitcher. Finding it classed as unskilled labor, she gave him $300 a week unemployment pay.

Sven was asked his occupation. 'Diesel fitter,' he replied. Since diesel fitter was a skilled job, the clerk gave Sven $600 a week. When Ole found out he was furious. He stormed back in to the office to find out why his friend and co-worker was collecting double his pay. The clerk explained: Panty stitchers were unskilled and diesel fitters were skilled labor.

'What skill?' yelled Ole. 'I sew the elastic on the panties, Sven pulls them down on his head and says, 'Yah, diesel fitter.'

Two midgets on a bender in Vegas hire two hookers and take 'em out for a night on the town. After cocktails and gambling, they all head back to their hotel room at the MGM Grand.

However, the night doesn't quite turn out as planned. Since he's had too much to drink, one of the midgets can't get it up at all, and, to make matters worse, he has to listen to the other one say "1, 2, 3, huh," over and over again, all night. The next morning, the first midget is complaining.

"Man, did that suck. I was soft all night."

"You think that's bad," said the other midget. "I couldn't even get onto the bed."

Two brothers, ages 8 and 10, were always getting into trouble. Their parents knew that if there was any trouble in town, their sons were probably involved. The boys' mother heard that a clergyman in town had been successful in straightening out young children, so she asked if he would speak with her boys. The clergyman agreed, but asked to see them individually. The mother sent her 8-year old first. The clergyman, a huge man with a booming voice, sat the younger boy down and asked him sternly, "Where is God?" The boy's mouth dropped open, but he made no response. So the clergyman repeated the question in an even sterner tone, "Where is God!!?" Again, the boy made no attempt to answer. The clergyman raised his voice even louder and shook his finger in the boy's face and bellowed, "WHERE IS GOD!?" The boy screamed and bolted from the room, ran home and dove into his closet. When his older brother found him, he asked, "What happened?" The younger brother, gasping for air, replied, "We are in BIG trouble this time. God is missing, and they think WE did it!!"

A man has a dog that snores in his sleep. Annoyed, because she can’t sleep, his wife goes to the vet to see if he can help. The vet tells the woman to tie a ribbon around the dog’s testicles and he will stop snoring.

A few hours after going to bed, the dog is snoring as usual. Finally, unable to sleep, she goes to the closet and grabs a piece of ribbon and ties it around the dog’s testicles, and sure enough, the dog stops snoring. The woman is amazed!

Later that night, her husband returns home drunk from being out with his buddies. He climbs into bed, falls asleep, and begins snoring very loudly. The woman thinks maybe the ribbon will work on him. So she goes to the closet again, grabs a piece of ribbon, and ties it around her husband’s testicles. Amazingly, it also works on him!

The woman sleeps very soundly.

The next morning, the husband wakes up very hung over.

He tumbles into the bathroom to urinate. As he is standing in front of the toilet, he looks in the mirror and sees a blue ribbon attached to his privates.

He is very confused, and, as he walks back into the bedroom, he notices a red ribbon attached to his dog’s testicles.

He shakes his head, looks down at the dog and says:

“Boy, don’t remember where we were or what we did, but, by God, we got first and second place!”

I need to know what would be a good equivilent mother board for a pt88pro-AREV:1.0A. Any info would be appreciated. Motherboard is made by ecs.

There is a factory in America which makes the Tickle Me Elmo toys. The toy laughs when you tickle it under the arm. A new employee is hired at the Tickle Me Elmo factory and she reports for her first day promptly at 8:00am. The next day at 8:45am there is a knock at the Personnel Manager's door. The foreman from the assembly line throws open the door and begins to rant about the new employee. He complains that she is incredibly slow and the whole line is backing up, putting the entire production line behind schedule. The personnel manager decides he should see this for himself so the 2 men march down to the factory floor. When they get there, the line is so backed up that there are Tickle Me Elmo's all over the factory floor and they're really beginning to pile up. At the end of the line stands the new employee surrounded by mountains of Tickle Me Elmo's. She has a roll of plush red fabric and a huge bag of small marbles. The 2 men watch in amazement as she cuts a little piece of fabric, wraps it around two marbles and begins to carefully sew the little package between Elmo's legs. The Personnel Manager bursts into laughter. After several minutes of hysterics he pulls himself together and approaches the woman. "I'm sorry," he says to her, barely able to keep a straight face, "but I think you misunderstood the instructions I gave you yesterday. Your job is to give Elmo two test TICKLES".

My daughter and I have been working on this all night and still don't have it right. Here is the problem.

The three strands of DNA below are all part of the DNA section that codes for the insulin protein. This section of DNA has been "cut" into three pieces. The sequences within each strand are in order, but the pieces are not. Your job in this assignment is to use transcription to code for mRNA based on these strands. By the time you finish with Lesson 14-15, you will have ordered the strands correctly and will be able to write the complete sequence of amino acids that forms the insulin protein.

DNA Molecule Part A: AATCTCCCATCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACGTTAACT

DNA Molecule Part B: TACAAACATTTAGTTGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGGGGGTTTTGG

DNA Molecule Part C: TCTTCCCTCGCGCTCCTAAACGTTCAACCGGTTCAACTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGG

Any help would be great.

A man has a dog that snores in his sleep. Annoyed, because she can’t sleep, his wife goes to the vet to see if he can help. The vet tells the woman to tie a ribbon around the dog’s testicles and he will stop snoring.

A few hours after going to bed, the dog is snoring as usual. Finally, unable to sleep, she goes to the closet and grabs a piece of ribbon and ties it around the dog’s testicles, and sure enough, the dog stops snoring. The woman is amazed!

Later that night, her husband returns home drunk from being out with his buddies. He climbs into bed, falls asleep, and begins snoring very loudly. The woman thinks maybe the ribbon will work on him. So she goes to the closet again, grabs a piece of ribbon, and ties it around her husband’s testicles. Amazingly, it also works on him!

The woman sleeps very soundly.

The next morning, the husband wakes up very hung over.

He tumbles into the bathroom to urinate. As he is standing in front of the toilet, he looks in the mirror and sees a blue ribbon attached to his privates.

He is very confused, and, as he walks back into the bedroom, he notices a red ribbon attached to his dog’s testicles.

He shakes his head, looks down at the dog and says:

“Boy, don’t remember where we were or what we did, but, by God, we got first and second place!”

All the organs of the body were having a meeting, trying to decide who was in charge.

The brain said: "I should be in charge, because I run all the body's systems, so without me nothing would happen."

"I should be in charge," said the heart, "because I pump the blood and circulate oxygen all over the body, so without me you'd all waste away."

"I should be in charge," said the stomach, "because I process food and give all of you energy."

"I should be in charge," said the rectum, "because I'm responsible for waste removal."

All the other body parts laughed at the rectum and insulted him, so in a huff, he shut down tight. Within a few days, the brain had a terrible headache, the stomach was bloated, and the blood was toxic. Eventually the other organs gave in. They all agreed that the rectum should be the boss.

The moral of the story?

You don't have to be smart or important to be in charge... just an *sshole